View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13786_high_12 (Length: 273)
Name: NF13786_high_12
Description: NF13786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13786_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 258
Target Start/End: Original strand, 12282542 - 12282791
Alignment:
| Q |
9 |
agcaaaggaaaatagatatcattgcactagcacaagatgtgccaaaaataacaccaatacaaagtcaccacttgagatttattgacataaggttatattg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12282542 |
agcaaaggaaaatagatatcattgcactagcacaagatgtgccaaaaataacaccaatacaaagtcaccacttgagatttattgacataaggttatattg |
12282641 |
T |
 |
| Q |
109 |
aaagcaaaaatctaggccaaacttatgggagtatagttcttctcctttttaacaaaaagcatgtcaccttgaaatttcacatgtatagcattttgtatgt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12282642 |
aaagcaaaaatctaggccaaacttatgggagtaaagttcttctcctttttaacaaaaagcatgtgaccttgaaatttcacatgtatagcattttgtatgt |
12282741 |
T |
 |
| Q |
209 |
gaaatggcacaagcaaatcacacaaaaagatccacaaaatagggaatttt |
258 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12282742 |
gaaatggcacaagctaatcacacaaaaagatccacaaaatagggaatttt |
12282791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University