View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13786_high_16 (Length: 243)
Name: NF13786_high_16
Description: NF13786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13786_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 17240222 - 17240430
Alignment:
| Q |
12 |
tatactacatgtccggtacgtatcttccggaggtacaaaaattaaattttaaaatgaacatcctatagttacctgttcgatgctcaagtagttacatacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
17240222 |
tatactacatgtccggtacgtatcttccggaggtacaaaaattaaattttaaaatgaacatcctatagttaccttttagatcctcaagtagttacatacc |
17240321 |
T |
 |
| Q |
112 |
ggatgtgttactaagtataaattcataatttcagagggtgtaaaaagatgt-gggggctaaaaagaaatcttccttcttttttcttttatgaaagcatac |
210 |
Q |
| |
|
|| ||||||||| |||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
17240322 |
gg--gtgttactaggtataaattcgtaatttcagagggcataaaaagatgtggggggctaaaaagaaatcttccttcttttttcttttatgaaagcaatc |
17240419 |
T |
 |
| Q |
211 |
cactttcaaac |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
17240420 |
cactttcaaac |
17240430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University