View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13786_high_19 (Length: 227)
Name: NF13786_high_19
Description: NF13786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13786_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41307201 - 41307424
Alignment:
| Q |
1 |
cccatctttaaggtacatatctcattaacctcaaccactgatttggttacttggttccatcaacattcattaaaaaacac--tgattatttggcctaaac |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41307201 |
cccatctttaaggtacatatcttattaacctcaaccactgatttggttacttggttccatcaacattcattaaaaaacactatgattatttggcctaaac |
41307300 |
T |
 |
| Q |
99 |
actttgtgacatgttaattgctagctgaaattccattannnnnnnnctcggatggattttgcttgctattcatagagaagaaattgctgcaacttacagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41307301 |
actttgtgacatgttaattgctagctgaaattccattattttttttctcggatggattttgcttgctattcatagagaagaaattgctgcaacttacagg |
41307400 |
T |
 |
| Q |
199 |
tatgtgttttttcttgtcgttttt |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41307401 |
tatgtgttttttcttgtcgttttt |
41307424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University