View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13786_low_20 (Length: 238)
Name: NF13786_low_20
Description: NF13786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13786_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 29385823 - 29386045
Alignment:
| Q |
1 |
ttacaacatgtggctttgttagttgtttcaatagtggaggcattgctcttgaaaccgtcggcgaatcttgccctcttgatgtagtagttgtgaaacataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29385823 |
ttacaacatgtggctttgttagttgtttcaatagtggaggcattgctcttgaaaccgtcggcgaatcttgccctcttgatgtagtagttgtgaaacataa |
29385922 |
T |
|
| Q |
101 |
tcaaggtttaccgttgaggttcacacccgttaacaacaagaaaggcgttgttcgtgtctccactgatctcaacataaggttctctaatgatgcttacgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
29385923 |
tcaaggtttaccgttgaggttcacacccgttaacaacaagaaaggcgttgttcgtgtctccactgatctcaacataaagttctctaatgatgcttatgat |
29386022 |
T |
|
| Q |
201 |
tctagatgtcctaaccattcctt |
223 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
29386023 |
tctagatgccctaaccattcctt |
29386045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 66 - 99
Target Start/End: Original strand, 29378567 - 29378600
Alignment:
| Q |
66 |
tcttgccctcttgatgtagtagttgtgaaacata |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
29378567 |
tcttgccctcttcatgtagtagttgtgaaacata |
29378600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University