View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13786_low_8 (Length: 304)
Name: NF13786_low_8
Description: NF13786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13786_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 288
Target Start/End: Complemental strand, 26498203 - 26497926
Alignment:
| Q |
11 |
atgaacgccttggtaatttacatttcaatttcaacattacattgattgactttttctgatcaaaattcatcaaactaatctttttgatttgtctattcag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
26498203 |
atgaacgccttggtaatttacatttcaatttcaacattacattgattggttttttctgattaaaatccatcaaactaatctttttaatttgtctattcag |
26498104 |
T |
 |
| Q |
111 |
cttcgtgtatcggcagtattgagcaatgctccttttgtgctcaacttggactgcaatcattatgtgaattacagcaaagttgtgagggaagccatgtgtt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26498103 |
cttcgtgtatcggcagtattgagcaatgctccttttgtgctcaacttggactgcaatcattatgtgaattacagcaaagttgtgagagaagccatgtgtt |
26498004 |
T |
 |
| Q |
211 |
tctttatggacattcaacttgggaatagtattgcctttgttcagtttccactaagatttgatagtcttgataggaatg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26498003 |
tctttatggacattcaacttgggaatagtattgcctttgttcagtttccactaagatttgatagtcttgataggaatg |
26497926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University