View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13787_low_22 (Length: 272)
Name: NF13787_low_22
Description: NF13787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13787_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 151 - 272
Target Start/End: Original strand, 53066313 - 53066434
Alignment:
| Q |
151 |
gttagatacctggaattgttattgttgattcttggtgaagaggggcgaggagcggatgatctgaaggactgaccaccaattctgccaccagttttggcag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53066313 |
gttagatacctggaattgttattgttgattcttggtgaagaggggcgaggagcggatgatctgaaggactgaccaccaattctgccaccagttttggcag |
53066412 |
T |
|
| Q |
251 |
ctgatgcatcatgaactgatcc |
272 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53066413 |
ctgatgcatcatgaactgatcc |
53066434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University