View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13788_low_11 (Length: 393)
Name: NF13788_low_11
Description: NF13788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13788_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 379
Target Start/End: Complemental strand, 43985565 - 43985187
Alignment:
| Q |
1 |
gttcagtgaaagaatatagaaaattaataggtgaaaatcaagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcgggaaaaagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43985565 |
gttcagtgaaagaatatagaaaattaataggtgaaaatcaagatgtgattcatggtttagttgaattggctaaagaaggaacaacctgcggaaaaaagaa |
43985466 |
T |
|
| Q |
101 |
tgcagtggttgccatttttggacttcttttgcttcctaggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaatacc |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985465 |
tgcagtggttgcgatttttggacttcttttgcttcctaggaatcatcaacgtgtgcttgaagccggtgctgttcacgcgcttgtttctattttgaatacc |
43985366 |
T |
|
| Q |
201 |
ttgtgcaacaaggaagagcttgttactgaaactttggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985365 |
ttgtgcaacaaggaagagcttgttactgaaactctggctgttcttgcggcacttgctgagaattttgatggagctaatgctgttttggaagcttctgcat |
43985266 |
T |
|
| Q |
301 |
tgccgttgattgctgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctct |
379 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43985265 |
tgccgttgattactgggctgttgcgatctgctccttcgcgtgctgcaaaggaacattgtgtttcgatattgttgtctct |
43985187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University