View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13788_low_3 (Length: 480)
Name: NF13788_low_3
Description: NF13788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13788_low_3 |
 |  |
|
| [»] chr7 (12 HSPs) |
 |  |
|
| [»] chr5 (12 HSPs) |
 |  |
|
| [»] chr3 (9 HSPs) |
 |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |
|
| [»] chr4 (18 HSPs) |
 |  |
|
| [»] chr2 (12 HSPs) |
 |  |
|
| [»] chr1 (14 HSPs) |
 |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] chr6 (8 HSPs) |
 |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 162 - 400
Target Start/End: Complemental strand, 17987864 - 17987626
Alignment:
| Q |
162 |
aatctgaataactttatcttttaatttgaaattttggtgtagttaactcttgtggaaattgatgcttcacaatctgaagaagaatattggaaatccgttt |
261 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17987864 |
aatctgaataactttttcttttaatttgaaattttggtgtagttaactcttgtggaaattgatgcttcacaatctgaagaagaatattggaaatccgttt |
17987765 |
T |
 |
| Q |
262 |
ggccaaacacttctatgccgaagactctcctcgacctatttatttcgggttagaccccctttgttatttttgattgtctatattttagaaatattgttac |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17987764 |
ggccaaacacttctatgccgaagactctcctcgacctgtttatttcgggttagaccccttttgttatttttgattgtctatattttagaaatattgttac |
17987665 |
T |
 |
| Q |
362 |
caattatgccatgatttcaatgttcaaggttaaattatg |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17987664 |
taattatgccatgatttcaatgttcaaggttacattatg |
17987626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 12 - 132
Target Start/End: Complemental strand, 17988055 - 17987935
Alignment:
| Q |
12 |
aatcataacaaagtcgaatcgagtttcgacttattcaatttttatcgagtcgatccaagctgaatctgatttggctcaggtcgactctttctagccttgg |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
17988055 |
aatcataacaaagtcgagtcgagtttcgacttattcaatttttatcgagttgatccaagctgaatctgatttggctcggctcgactctttctagccttgg |
17987956 |
T |
 |
| Q |
112 |
aaattatatacatcatgaaat |
132 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17987955 |
aaattatatacatcatgaaat |
17987935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 441 - 480
Target Start/End: Complemental strand, 30942689 - 30942650
Alignment:
| Q |
441 |
cataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30942689 |
cataactcaattgataggacaatgcattattatatgcagg |
30942650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 7540582 - 7540539
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
7540582 |
tgagcataactcacttggtaggacaatgcattattatatgcagg |
7540539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 223 - 290
Target Start/End: Original strand, 17105978 - 17106045
Alignment:
| Q |
223 |
atgcttcacaatctgaagaagaatattggaaatccgtttggccaaacacttctatgccgaagactctc |
290 |
Q |
| |
|
||||||||||||| | ||||| ||||||||| || |||||||||||||| ||||||| ||| ||||| |
|
|
| T |
17105978 |
atgcttcacaatcgggggaagattattggaaaaccatttggccaaacactcctatgcctaaggctctc |
17106045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 479
Target Start/End: Complemental strand, 40249979 - 40249932
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
40249979 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcag |
40249932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 476
Target Start/End: Complemental strand, 43875071 - 43875032
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
43875071 |
tgagcataactcagttgataggacaatgcattattatatg |
43875032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 437 - 478
Target Start/End: Complemental strand, 26703984 - 26703943
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgca |
478 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
26703984 |
tgagcataactcagttggtaggacaatgcattattatatgca |
26703943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 2376514 - 2376562
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2376514 |
tcccgtgagcatagttcaattggtaggacaatgcattattatatgcagg |
2376562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 3379745 - 3379697
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||||||||| | |||||| ||||||||||| |
|
|
| T |
3379745 |
tcccgtgagcataactcagttgataggataatgcattgttatatgcagg |
3379697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 8034526 - 8034574
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||||||| || |||||||| |||||||||||||||||| |
|
|
| T |
8034526 |
tcccgtgagcataactccgttaataggacaatgcattattatatgcagg |
8034574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 9524953 - 9525001
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
9524953 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
9525001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 15042464 - 15042416
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
15042464 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
15042416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 23857423 - 23857375
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
23857423 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
23857375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 24608582 - 24608534
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
24608582 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
24608534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 25119204 - 25119252
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| ||||||| ||||||| |||||||||||||||||| |
|
|
| T |
25119204 |
tcccgtgagcatagttcaattggtaggacaatgcattattatatgcagg |
25119252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 28465614 - 28465662
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
28465614 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
28465662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 39484469 - 39484421
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
39484469 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
39484421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.00000000001; HSPs: 12)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 28694285 - 28694237
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
28694285 |
tcccatgagcatagctcagttgataggacagtgcattattatatgcagg |
28694237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 2366353 - 2366401
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||| |||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2366353 |
tcccgtgagtataactcagttgataggacaatgcattattatatgcagg |
2366401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 22966057 - 22966009
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
22966057 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
22966009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 23685653 - 23685605
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23685653 |
tcccatgagcatagctcagttgataggacaatgcattattatatgcagg |
23685605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 2261578 - 2261535
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
2261578 |
tgagcatagctcaattggtaggacaatgcattattatatgcagg |
2261535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 476
Target Start/End: Original strand, 24479584 - 24479623
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
24479584 |
tgagcatagctcaattggtaggacagtgcattattatatg |
24479623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Original strand, 38025342 - 38025385
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
38025342 |
tgagcatagctcatttgataggacaatgcattattatatgcagg |
38025385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 432 - 478
Target Start/End: Original strand, 4104476 - 4104522
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgca |
478 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
4104476 |
tcccgtgagcatagctcaattgttaggacaatgcattattatatgca |
4104522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 430 - 480
Target Start/End: Original strand, 5787455 - 5787505
Alignment:
| Q |
430 |
tatcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||| |||| ||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
5787455 |
tatcccgtgagtatagctcaattggtaggacaatgcattattatatgcagg |
5787505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 426 - 480
Target Start/End: Complemental strand, 38778784 - 38778730
Alignment:
| Q |
426 |
taattatcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||| |||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
38778784 |
taattgtcccgtgagcatatctcagttggtaggacaatgcattattatatgcagg |
38778730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 25818282 - 25818330
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||| | |||||||||||||||||| |
|
|
| T |
25818282 |
tcccgtgagcataactcagttggtaggataatgcattattatatgcagg |
25818330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 29778977 - 29779025
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||| | |||||||||||||||||| |
|
|
| T |
29778977 |
tcccgtgagcatagctcaattggtaggataatgcattattatatgcagg |
29779025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 20945990 - 20945942
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
20945990 |
tcccgtgagcataactcaattggtaggacaatgcattattatatgcagg |
20945942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 29266064 - 29266112
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
29266064 |
tcccgtgagcatagctcaattgataggacaatgcattattatatgcagg |
29266112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 437 - 480
Target Start/End: Original strand, 23925544 - 23925587
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
23925544 |
tgagcataactcagttgataggacaatgcattattatatgcagg |
23925587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 22600034 - 22599986
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
22600034 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
22599986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 33800889 - 33800937
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
33800889 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
33800937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 29106132 - 29106089
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
29106132 |
tgagcatagctcaattggtaggacaatgcattattatatgcagg |
29106089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 431 - 480
Target Start/End: Original strand, 18872516 - 18872565
Alignment:
| Q |
431 |
atcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
18872516 |
atcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
18872565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 434 - 479
Target Start/End: Complemental strand, 27440395 - 27440350
Alignment:
| Q |
434 |
ccctgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
||||||||||| |||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
27440395 |
ccctgagcatagctcagttggtaggacaatgcattattatatgcag |
27440350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 9176885 - 9176837
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| |||||| |||||||||||||||||| |
|
|
| T |
9176885 |
tcccgtgagcataactcagttggaaggacaatgcattattatatgcagg |
9176837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 32158513 - 32158465
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||| || |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
32158513 |
tcccgtgagcttagctcaattggtaggacaatgcattattatatgcagg |
32158465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 36888192 - 36888144
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
36888192 |
tcccgtgagcatatctcagttggtaggacaatgcattattatatgcagg |
36888144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 42595737 - 42595785
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| | |||||||||||||||| |
|
|
| T |
42595737 |
tcccgtgagcatagctcaattggtaggacaatacattattatatgcagg |
42595785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 437 - 480
Target Start/End: Original strand, 33072291 - 33072334
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
33072291 |
tgagcataactcagttgataggacaatgcattattatatgcagg |
33072334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 2564917 - 2564965
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
2564917 |
tcccgtgagcataactcagttggtagaacagtgcattattatatgcagg |
2564965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 14417864 - 14417912
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
14417864 |
tcccatgagcatagctcaattggtaggacaatgcattattatatgcagg |
14417912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 476
Target Start/End: Complemental strand, 48516181 - 48516142
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
48516181 |
tgagcataactcaattgataggacaatacattattatatg |
48516142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 437 - 479
Target Start/End: Original strand, 41121872 - 41121914
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
41121872 |
tgagcataactcagttggtaggacaatgcattattatatgcag |
41121914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 430 - 480
Target Start/End: Original strand, 49146078 - 49146128
Alignment:
| Q |
430 |
tatcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||| ||||| ||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
49146078 |
tatcccgtgagcttaactcagttggtaggacaatgcattattatatgcagg |
49146128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 480
Target Start/End: Complemental strand, 34344869 - 34344828
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34344869 |
agcatagctcagttgataggacaatgcattattatatgcagg |
34344828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 32508893 - 32508845
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||| ||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
32508893 |
tcccgtgagcctaactcagttgataggataatgcattattatatgcagg |
32508845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 33206753 - 33206801
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
33206753 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
33206801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 159010 - 159058
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
159010 |
tcccatgagcataactcagttggtaggacaatgcattattatatgcagg |
159058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 9172470 - 9172422
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
9172470 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
9172422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 9285758 - 9285710
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9285758 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
9285710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 52560760 - 52560808
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
52560760 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
52560808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 56546548 - 56546500
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
56546548 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
56546500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 49280763 - 49280720
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
49280763 |
tgagcataactcaattggtaggacaatgaattattatatgcagg |
49280720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 480
Target Start/End: Original strand, 3465586 - 3465627
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
3465586 |
agcataactcagttggtaggacaatgcattattatatgcagg |
3465627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 480
Target Start/End: Complemental strand, 35803185 - 35803144
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35803185 |
agcatagctcaattggtaggacaatgcattattatatgcagg |
35803144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 534864 - 534816
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| ||||| |||||||||||| |
|
|
| T |
534864 |
tcccgtgagcatagctcaattggtaggacaatgcatcattatatgcagg |
534816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 21476180 - 21476132
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||||||||| | |||||||||||||||||| |
|
|
| T |
21476180 |
tcccgtgagcatagctcagttgataggatattgcattattatatgcagg |
21476132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 33944462 - 33944414
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||| | |||||||||||||||||| |
|
|
| T |
33944462 |
tcccgtgagcataactcagttggtaggataatgcattattatatgcagg |
33944414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 443 - 479
Target Start/End: Complemental strand, 42558944 - 42558908
Alignment:
| Q |
443 |
taactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
42558944 |
taactcagttgataggacaatgcattattatatgcag |
42558908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 43606199 - 43606151
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||| |||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43606199 |
tcccgtgaacatagctcagttgataggacaatgcattattatatgcagg |
43606151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 439 - 479
Target Start/End: Original strand, 45350279 - 45350319
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
45350279 |
agcatagctcagttggtaggacagtgcattattatatgcag |
45350319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 439 - 479
Target Start/End: Original strand, 45359758 - 45359798
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
45359758 |
agcatagctcagttggtaggacagtgcattattatatgcag |
45359798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 46735068 - 46735020
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
46735068 |
tcccgtgagcatagctcagttggtaggacactgcattattatatgcagg |
46735020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 47018045 - 47017997
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
47018045 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
47017997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 50657876 - 50657924
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
50657876 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
50657924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 50783533 - 50783485
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
50783533 |
tcccgtgagcatagctcagttggtaggacattgcattattatatgcagg |
50783485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000003; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 10262735 - 10262783
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
10262735 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
10262783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 31564091 - 31564139
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
31564091 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
31564139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 26807178 - 26807135
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
26807178 |
tgagcataactcagttggtaggacaatgcattattatatgcagg |
26807135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 475
Target Start/End: Original strand, 33956252 - 33956295
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatat |
475 |
Q |
| |
|
|||| ||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
33956252 |
tcccgtgagcataactcaattggtaggacaatgcattattatat |
33956295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 426 - 480
Target Start/End: Original strand, 3179314 - 3179368
Alignment:
| Q |
426 |
taattatcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||| |||| ||||||||||||| ||| ||| ||| |||||||||||||||||| |
|
|
| T |
3179314 |
taattgtcccgtgagcataactcagttggtagaacaatgcattattatatgcagg |
3179368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 476
Target Start/End: Complemental strand, 20122579 - 20122530
Alignment:
| Q |
427 |
aattatcccctgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
||||||||| |||||||| |||| ||| ||||||| |||||||||||||| |
|
|
| T |
20122579 |
aattatcccgtgagcatagctcagttggtaggacaatgcattattatatg |
20122530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 580882 - 580834
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
580882 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
580834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 476
Target Start/End: Complemental strand, 15392310 - 15392266
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
15392310 |
tcccgtgagcataactcagttggtaggacaatgcattattatatg |
15392266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 17154645 - 17154693
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
17154645 |
tcccgtgagcataactcggttggtaggacaatgcattattatatgcagg |
17154693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 22538535 - 22538583
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||| ||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
22538535 |
tcccgtgagcctaactcagttggtaggacaatgcattattatatgcagg |
22538583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 30474294 - 30474246
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
30474294 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
30474246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 476
Target Start/End: Original strand, 37245374 - 37245418
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
|||| ||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37245374 |
tcccatgatcatagctcaattggtaggacagtgcattattatatg |
37245418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 5172701 - 5172653
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5172701 |
tcccgtgagcatagctcagttgataggacaatgcattattatatgcagg |
5172653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 20357456 - 20357504
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
20357456 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
20357504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 20562499 - 20562451
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
20562499 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
20562451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 21884571 - 21884619
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
21884571 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
21884619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 24661978 - 24662026
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
24661978 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcagg |
24662026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 37490886 - 37490934
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
37490886 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcagg |
37490934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Original strand, 19793527 - 19793570
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
19793527 |
tgagcataactcagttggtaggacaatgcattattatatgcagg |
19793570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 49251489 - 49251446
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
49251489 |
tgagcataactcagttggtaggacaatgcattattatatgcagg |
49251446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 11067435 - 11067483
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||| | ||| |||||||||||||||| ||||||||| |
|
|
| T |
11067435 |
tcccgtgagcataacttagttggtaggacagtgcattataatatgcagg |
11067483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 476
Target Start/End: Complemental strand, 15774411 - 15774367
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
15774411 |
tcccgtgagcataactcagttggtaggacaatgcattattatatg |
15774367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 18923984 - 18923936
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
18923984 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
18923936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 38020047 - 38019999
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
38020047 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
38019999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 42831943 - 42831991
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
42831943 |
tcccgtgagcatagctcagttggtaggacattgcattattatatgcagg |
42831991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 43092149 - 43092197
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| ||||||||||||||||| ||||| | | |||||||||||||||| |
|
|
| T |
43092149 |
tcccatgagcataactcaattggtaggataatacattattatatgcagg |
43092197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 479
Target Start/End: Original strand, 2484 - 2531
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
2484 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcag |
2531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 437 - 480
Target Start/End: Complemental strand, 5288439 - 5288396
Alignment:
| Q |
437 |
tgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
5288439 |
tgagcataactcagttggtaggacaatgcattattatatgcagg |
5288396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 479
Target Start/End: Original strand, 30566054 - 30566101
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
30566054 |
tcccgtgagcataactcagttggtaggacaatgcattattatatgcag |
30566101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 432 - 479
Target Start/End: Original strand, 32057030 - 32057077
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcag |
479 |
Q |
| |
|
|||| |||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
32057030 |
tcccgtgagcatagctcagttgataggacaatgcattattatatgcag |
32057077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 439 - 480
Target Start/End: Original strand, 23771036 - 23771077
Alignment:
| Q |
439 |
agcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
23771036 |
agcatagctcaattggtaggacaatgcattattatatgcagg |
23771077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 476
Target Start/End: Complemental strand, 9491834 - 9491790
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatg |
476 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
9491834 |
tcccgtgagcataactcagttggtaggacaatgcattattatatg |
9491790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 12089093 - 12089141
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
12089093 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
12089141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Complemental strand, 22389849 - 22389801
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
22389849 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcagg |
22389801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 432 - 480
Target Start/End: Original strand, 22501014 - 22501062
Alignment:
| Q |
432 |
tcccctgagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
|||| |||||||| |||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
22501014 |
tcccatgagcatagctcagttggtaggacaatgcattattatatgcagg |
22501062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 438 - 480
Target Start/End: Original strand, 5306 - 5348
Alignment:
| Q |
438 |
gagcataactcaattgataggacagtgcattattatatgcagg |
480 |
Q |
| |
|
||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
5306 |
gagcatagctcaattggtaggacaatgcattattatatgcagg |
5348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University