View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13789_high_24 (Length: 373)
Name: NF13789_high_24
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13789_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 4e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 8446063 - 8445876
Alignment:
| Q |
18 |
cttgtttctattgtggatt-ggaatactctgtctcccaaaagcgacatcgcccctgcccatgccttattcaaacttgggaccatagcatacactagtgga |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446063 |
cttgtttctattgtggatttggaatactctgtctcccaaaagcgacatcacccctgcccatgctttattcaaacttgggaccatagcatacactagtgga |
8445964 |
T |
|
| Q |
117 |
gttccagggttttcattcaagattatgatagcaacaagtataaattagtaacaaaatcacttaacttggataataataattagaaggcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445963 |
gttccagggttttcattcaagattatgatagcaacaagtataaattagtaac-aaatcacttaacttggataataataattagaaggcc |
8445876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 307 - 367
Target Start/End: Complemental strand, 8445874 - 8445814
Alignment:
| Q |
307 |
ttgtgtgtgctttagtaggcttagagcgccaaatattatagggaggttcagtctgtgctgc |
367 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8445874 |
ttgtgtgtgctttggtaggcttagagcgccaaatattatagggaggttcagtctgtgctgc |
8445814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 189 - 232
Target Start/End: Complemental strand, 43062010 - 43061967
Alignment:
| Q |
189 |
ataataattagaaggccaaacacaaaacaataccaaaatctaaa |
232 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
43062010 |
ataataattagaagaccaaccacaaaacaataccaaaatctaaa |
43061967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University