View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13789_high_29 (Length: 301)
Name: NF13789_high_29
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13789_high_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 47352732 - 47352446
Alignment:
| Q |
1 |
agaggttttggggaagttaaggtgggagtaaattagtgaagtgagttcatcaaagaaaaataagttgttatttgtttgtttcaaaaggttaaggttttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352732 |
agaggttttggggaagttaaggtgggagtaaattagtgaagtgagttcatcaaagaaaaataagttgttatttgtttgtttcaaaaggttaaggttttag |
47352633 |
T |
 |
| Q |
101 |
gtggaggatggatattttctgatgatcaaaggggaggggaagagacggtagagagtgggatagaggagagagaaaggcaatttggtgaggttgatgcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47352632 |
gtggaggatggatattttctgatgatcaaaggggaggggaagagacggtagagagtgggatagaggagagagaaaggcaatttggtgaggttgatgcata |
47352533 |
T |
 |
| Q |
201 |
ataaaattagttagctcaattaaaccaacagtctagaaataatgatttctgtagatcaactaatactgtggtcaaccatagattttg |
287 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47352532 |
ataaaatttgttagctcaattaaaccaacagtctagaaataatgatttctgtagaccaactaatactgtggtcaaccatagattttg |
47352446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University