View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13789_high_39 (Length: 239)
Name: NF13789_high_39
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13789_high_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 375930 - 376125
Alignment:
| Q |
17 |
agaatcttgatgaaatgaatatcgagtataaaacagcagttgtggaggatggtggaattcaggttgatcaattgttctttcatgatccagatggatatat |
116 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
375930 |
agaaccttgatgaaatgaatattgagtataaaacagcagttgtggaggatggtggaattaaggttgatcaattgttctttcatgatccagatggatatat |
376029 |
T |
|
| Q |
117 |
gattgaaatgtgcaattgccaaaatctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
376030 |
gattgaaatgtgcaattgccaaaatctccctgtgcttcctatttccacttgccctctaaagcagccaactaatcaagcaccagtacccttttatgg |
376125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 44544876 - 44544811
Alignment:
| Q |
69 |
tggaattcaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg |
134 |
Q |
| |
|
||||||||| || ||||||||||| |||||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
44544876 |
tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg |
44544811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 44555518 - 44555453
Alignment:
| Q |
69 |
tggaattcaggttgatcaattgttctttcatgatccagatggatatatgattgaaatgtgcaattg |
134 |
Q |
| |
|
||||||||| || ||||||||||| |||||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
44555518 |
tggaattcaagtggatcaattgttttttcatgacccagatggatttatgattgaaatatgcaattg |
44555453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University