View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13789_low_28 (Length: 301)
Name: NF13789_low_28
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13789_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 24 - 221
Target Start/End: Original strand, 25698132 - 25698335
Alignment:
| Q |
24 |
tagagacacgtctgcctcacactctatgtcagagaaaaccgtgtttttgcttatggatcgatttgtcccttggtgattttgtagctt------cttgtgn |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | || || |||||| |
|
|
| T |
25698132 |
tagagacacctctgcctcacactctatgtcagagaaaactgtgtttttgcttatggatcgatttgtcccttggtgatgatatatattttgtagcttgtgt |
25698231 |
T |
|
| Q |
118 |
nnnnnngttacaagattaattaagatgcatggtttgtattgcatatctactcgatcgatcaatgcattttaattttcatagtccgtgagacttaatatgc |
217 |
Q |
| |
|
| |||||||||||||||||||||||||| ||||| |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25698232 |
tcttttctaacaagattaattaagatgcatggtttttattgtatatatactcgatcgatctatgcattttaattttcatagtccgtgagacttaatatgc |
25698331 |
T |
|
| Q |
218 |
aaat |
221 |
Q |
| |
|
|||| |
|
|
| T |
25698332 |
aaat |
25698335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 128 - 199
Target Start/End: Original strand, 25681666 - 25681737
Alignment:
| Q |
128 |
caagattaattaagatgcatggtttgtattgcatatctactcgatcgatcaatgcattttaattttcatagt |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||| |||| |||||||| ||| || ||| |||||||||| |
|
|
| T |
25681666 |
caagattaattgagatgcatggtttgtattgtatatatacttgatcgatctatgtatgttacttttcatagt |
25681737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 47 - 100
Target Start/End: Original strand, 25681552 - 25681605
Alignment:
| Q |
47 |
ctatgtcagagaaaaccgtgtttttgcttatggatcgatttgtcccttggtgat |
100 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
25681552 |
ctatgtcagaggcaaccgtgtgtttgcttatggatcgatttgttccttggtgat |
25681605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University