View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13789_low_36 (Length: 259)
Name: NF13789_low_36
Description: NF13789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13789_low_36 |
 |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 144 - 242
Target Start/End: Complemental strand, 40889598 - 40889500
Alignment:
| Q |
144 |
agtggtaaactagtcttacctattctactaacgcaacacctgagaccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40889598 |
agtggtaaactagtcttacctattctactaacgcaacacctgataccaatagcatagttatatgatttacttttatttgaaaagtagaaaggggttagt |
40889500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 42 - 84
Target Start/End: Complemental strand, 25202 - 25160
Alignment:
| Q |
42 |
tcgacgtggttctctcaagcgccctagtatactctacttgttc |
84 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25202 |
tcgacatggttctctcaagcgccctagtatactctacttgttc |
25160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 143
Target Start/End: Complemental strand, 11593153 - 11593117
Alignment:
| Q |
107 |
gtcagttcaccgggaggatcgccctcccaattcgaag |
143 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11593153 |
gtcagttcattgggaggatcgccctcccaattcgaag |
11593117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University