View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1378_low_16 (Length: 288)
Name: NF1378_low_16
Description: NF1378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1378_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 96; Significance: 4e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 102 - 209
Target Start/End: Original strand, 30239666 - 30239773
Alignment:
| Q |
102 |
ctagtcaagaaggatatccaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagcaacgaatctactt |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
30239666 |
ctagtcaagaaggatatcaaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagcaaagcatctactt |
30239765 |
T |
 |
| Q |
202 |
cttttcat |
209 |
Q |
| |
|
|||||||| |
|
|
| T |
30239766 |
cttttcat |
30239773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University