View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1378_low_17 (Length: 284)
Name: NF1378_low_17
Description: NF1378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1378_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 35165755 - 35165545
Alignment:
| Q |
35 |
gaggaggagcagagaagcacaagcatgaagataagtacatgtaaaatgaaaaagcgagaaattcattggtgtatgcataaaatatagttatatggtacaa |
134 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165755 |
gaggaggaccaaagaagcacaagcatgaagataagtacatgtaaaatgaaaaagcgagaaattcattggtgtatgcataaaatatagttatatggtacaa |
35165656 |
T |
|
| Q |
135 |
atgatgaggaaa----------------gacaaaag-------aaatatcaatgaagcaatttgcttggtcttacaatgaggtttcaaaacatgattttg |
211 |
Q |
| |
|
|||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165655 |
atgatgaggagattattttgaagcttttgacaaaagacaaaagaaatatcaatgaagcaatttgcttggtcttacaatgaggtttcaaaacatgattttg |
35165556 |
T |
|
| Q |
212 |
agtactgtatg |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
35165555 |
agtactgtatg |
35165545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 35 - 140
Target Start/End: Original strand, 44791862 - 44791967
Alignment:
| Q |
35 |
gaggaggagcagagaagcacaagcatgaagataagtacatgtaaaatgaaaaagcgagaaattcattggtgtatgcataaaatatagttatatggtacaa |
134 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44791862 |
gaggaggaccaaagaagcacaagcatgaagataagtacgtgtaaaatgaaaaagcgagaaattcattggtgtatgcataaaatatagttatatggtacaa |
44791961 |
T |
|
| Q |
135 |
atgatg |
140 |
Q |
| |
|
|||||| |
|
|
| T |
44791962 |
atgatg |
44791967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 44792008 - 44792084
Alignment:
| Q |
144 |
aaagacaaaagaaatatcaatgaagcaatttgcttggtcttacaatgaggtttcaaaacatgattttgagtactgta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44792008 |
aaagacaaaagaaatatcaatgaagcaatttgcttggtcttacaatgaggtttcaaaacatgattttgagtactgta |
44792084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University