View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379-INSERTION-2 (Length: 88)
Name: NF1379-INSERTION-2
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379-INSERTION-2 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 42639087 - 42639147
Alignment:
| Q |
28 |
aaaatatatataacaatgtagaaattgtttcnnnnnnntatttgttattgttgtgaacttt |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
42639087 |
aaaatatatataacaatgtagaaattgtttcaaaaaaatatttgttatcgttgtgaacttt |
42639147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University