View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379-INSERTION-4 (Length: 121)
Name: NF1379-INSERTION-4
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379-INSERTION-4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 26993278 - 26993391
Alignment:
| Q |
8 |
tcttcatactgcagaactaggcagaataccagatgtgtgtgcactttgtgaggaatatactaccaaggcacttgattatataaatgaaaacaagactcag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26993278 |
tcttcatactgcagaactaggcagaataccagatgtgtgtgcactttgtgaggaatatactaccaaggcacttgattatataaatgaaaacaagactcag |
26993377 |
T |
|
| Q |
108 |
agtgagatcattga |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26993378 |
agtgagatcattga |
26993391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 29 - 107
Target Start/End: Complemental strand, 10002402 - 10002324
Alignment:
| Q |
29 |
cagaataccagatgtgtgtgcactttgtgaggaatatactaccaaggcacttgattatataaatgaaaacaagactcag |
107 |
Q |
| |
|
||||| |||||||| |||| || ||||||||||||||||||| || ||||||||| |||| || |||||||||||| |
|
|
| T |
10002402 |
cagaaaaccagatgcgtgttcaatttgtgaggaatatactactgagattcttgattatctaaaggataacaagactcag |
10002324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University