View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379-INSERTION-8 (Length: 487)
Name: NF1379-INSERTION-8
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379-INSERTION-8 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 468; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 468; E-Value: 0
Query Start/End: Original strand, 8 - 487
Target Start/End: Original strand, 39751358 - 39751837
Alignment:
| Q |
8 |
gtggtttcgttgctgttatcatcgatggttcaaaaattagtagacccttctactgatccaattggttatacaaagctcatttttcttgccacactctttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751358 |
gtggtttcgttgctgttatcatcgatggttcaaaaattagtagacccttctactgatccaattggttatacaaagctcatttttcttgccacactctttg |
39751457 |
T |
|
| Q |
108 |
ctggtatctttcaaacttcatttggattattcaggtgaaaattatcttcttgtactaactaataactatgtctatagccataacctcttttgtttttctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751458 |
ctggtatctttcaaacttcatttggactattcaggtgaaaattatcttcttgtactaactaataactatgtctatagccataacctcttttgtttttctt |
39751557 |
T |
|
| Q |
208 |
tatgtgtagttactacattattaatgaaacggtttgttatgtaataacaggttggggttccttgtggattttccgtcacatgctgcaattgttggatttg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39751558 |
tatgtgtagttactacattattaatgaaacggtttgttatgtaataacaggttggggttccttgtggattttctgtcacatgctgcaattgttggatttg |
39751657 |
T |
|
| Q |
308 |
tagcaggagctgccattgtgattggtcttcaacagttaaagggactgtttggaattacacattttacaaccaaaacagacataatctctgtcttgaaagc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39751658 |
tagcaggagctgccattgtgattggtcttcaacagttaaagggactgtttggaattacacattttacaaccaaaacagacataatctctgtcttgaaagc |
39751757 |
T |
|
| Q |
408 |
tgtttgggaagcatttcataaccctgtatgctactactttttctttgtttttactataaatagcatataaacatgttaat |
487 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
39751758 |
tgtttgggaagcatttcataaccctgtatgctactactttttcttcgtttttactataaatagcatataaacatgttaat |
39751837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 255 - 335
Target Start/End: Complemental strand, 33270399 - 33270319
Alignment:
| Q |
255 |
caggttggggttccttgtggattttccgtcacatgctgcaattgttggatttgtagcaggagctgccattgtgattggtct |
335 |
Q |
| |
|
||||||||| || |||||||||||| ||||||||||||| |||| ||||| | ||||| || ||||| |||||||||| |
|
|
| T |
33270399 |
caggttgggatttcttgtggattttttgtcacatgctgcacttgtaggattcatggcaggtgcagccatcatgattggtct |
33270319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 254 - 386
Target Start/End: Complemental strand, 25707238 - 25707106
Alignment:
| Q |
254 |
acaggttggggttccttgtggattttccgtcacatgctgcaattgttggatttgtagcaggagctgccattgtgattggtcttcaacagttaaagggact |
353 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||||||| | |||||||| | |||||||| || || | ||||||||||| ||| | ||||| || |
|
|
| T |
25707238 |
acaggttgggttttcttgtggattttctttcacatgctgcactagttggattcatggcaggagcagcaatcattattggtcttcagcagctcaagggtct |
25707139 |
T |
|
| Q |
354 |
gtttggaattacacattttacaaccaaaacaga |
386 |
Q |
| |
|
|| || ||||| || || || ||||||||||| |
|
|
| T |
25707138 |
tttggggattactcacttcaccaccaaaacaga |
25707106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University