View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13791_high_25 (Length: 251)
Name: NF13791_high_25
Description: NF13791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13791_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 42410685 - 42410462
Alignment:
| Q |
21 |
ggagcagcggtcgaagatgaagatgacgccggcaacggagttggatcggcggttatcagatccattagcgtggttccggaagagtcctgcataaatcgaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410685 |
ggagcagcggtcgaagatgaagatgacgccggcaacggagttggatcggcggttatcagatccattagcgtggttccggaagagtcctgcataaatcgaa |
42410586 |
T |
|
| Q |
121 |
gagttaggaacgtgaagcgtgaagttcgaatttcgtatagtgtgagaaagtgaaagagattaccgccattgattctttgctgttttgtgatttgtgaaat |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410585 |
gagttaggaacgtgaagcgtgaagttcgaatttcgtatagtgtgagaaagtgagagagattaccgccattgattctttgctgttttgtgatttgtgaaat |
42410486 |
T |
|
| Q |
221 |
tgtgatcgcgttttcggttctgtg |
244 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
42410485 |
tgtgatcgcgttttcggttttgtg |
42410462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University