View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13791_low_19 (Length: 297)
Name: NF13791_low_19
Description: NF13791
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13791_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 280
Target Start/End: Original strand, 13115071 - 13115334
Alignment:
| Q |
16 |
caagatcttgaggaatgtggcttcaggtgcaggtactgatttccccttattcgtcgtactttgagtgttttctttatgcaaattgatcttgggacaaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13115071 |
caagatcttgaggaatgtggcttcaggtgcaggtactgatttccccctattcgtcgtactttgagtgttttctttatgcgaattgatcttgggacaaaat |
13115170 |
T |
 |
| Q |
116 |
tttcccatcttatgatgtcttcaaagccttattcatcgacaatcttcattccatatcttctaaagcatttttcaacattcaaacttgtgctaaaactccc |
215 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
13115171 |
ttccgcatcttatgatgtcttcaaagccttattcattgacaatcttcattccatatcttctaaagcattttttaacattcaaactggtgctaaaactccc |
13115270 |
T |
 |
| Q |
216 |
tctttatagacctcgccgcacatttacgcctgggggcaaaggaatatacctaaaactcccacttg |
280 |
Q |
| |
|
||||||||||||||| ||| |||| |||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
13115271 |
tctttatagacctcgtcgcgaatttgcgcc-aggggcaaaggaacgtaccttaaactcccacttg |
13115334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 68 - 148
Target Start/End: Original strand, 1870991 - 1871070
Alignment:
| Q |
68 |
gtcgtactttgagtgttttctttatgcaaattgatcttgggacaaaattttcccatcttatgatgtcttcaaagccttatt |
148 |
Q |
| |
|
||||| ||||||||||||| || | | | |||||||||||||||| ||| |||| ||| | ||||||||||||||||||| |
|
|
| T |
1870991 |
gtcgttctttgagtgtttttcttcttcgacttgatcttgggacaaattttccccacctt-taatgtcttcaaagccttatt |
1871070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University