View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13792_low_10 (Length: 351)
Name: NF13792_low_10
Description: NF13792
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13792_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 44856353 - 44856137
Alignment:
| Q |
1 |
ttttaaaacgtggagaagtagaaaatctggagttcgaactccgatccctactc----tatctgtgatagttaccaactgagctgcgcttactgaacaatc |
96 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
44856353 |
ttttaaaatgtggagaagtagaaaatctggagttcgaactccgatccctgcagataatatctgtgatagctaccaactgagctgcacttacggaacaatc |
44856254 |
T |
 |
| Q |
97 |
aaatatcttccttaattagtgtgaaagtaggtaattttgcttatccttaagtctgaatgatgttttgttgagcaaatcgcaatgaagttcaaatgaattt |
196 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44856253 |
aaatatcatccttaattagtgtgaaagtaggtaattttgcttatccttaagtatgaatgatgttttgttgagcaaatcgcaatgaaggtcaaatgaattt |
44856154 |
T |
 |
| Q |
197 |
tattggtaaatgaaaaa |
213 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44856153 |
tattggtaaatgaaaaa |
44856137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 203 - 336
Target Start/End: Complemental strand, 44855954 - 44855821
Alignment:
| Q |
203 |
taaatgaaaaatttgcattctaaaattgtaagggtcgatcttttacccctcaaaatttgcaattgacaaaatgacattggtcttgaatgacgttggacac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44855954 |
taaatgaaaaatttgcattctaaaattgtaagggtcgatcttttacccctcaaaatttgcaattgacaaaatgacattggtcttgaatgacgttggacac |
44855855 |
T |
 |
| Q |
303 |
ctaggtccttatgttaacttgcaatgactagttt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44855854 |
ctaggtccttatgttaacttgcaatgactagttt |
44855821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University