View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13793_high_10 (Length: 273)
Name: NF13793_high_10
Description: NF13793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13793_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 2501012 - 2500756
Alignment:
| Q |
1 |
aagtgagtttcgttggtgcgttcatccatttggatattgtaatttgnnnnnnnngagaatattcttgatatatgcttcaatttcaaaagaaatttaaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2501012 |
aagtgagtttcgttggtgcgttcatccattgggatattgtaatttgttttttttgagaatattct-gatatatgcttcaatttcaaaagaaatttaaaaa |
2500914 |
T |
 |
| Q |
101 |
tatttatatggatatatatatgtgattcgtgaagaagattgcatgcagatgtctgttgatcatgtattggatcctgaatgagtcaaaactaggtacttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2500913 |
tatttatatggatatatatatgtgattcgtgaagaagattgcatgcagatgtctgttgatcatgtattggatcctgaatgagtcaaaactaggtacttgt |
2500814 |
T |
 |
| Q |
201 |
tagtgggtgtgcaaaaaggcacctgcacttaagggacatgtatatagtggcaccatga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2500813 |
tagtgggtgtgcaaaaaggcacctgcacttaagggacatgtatatagtggcaccatga |
2500756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University