View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13793_high_4 (Length: 394)
Name: NF13793_high_4
Description: NF13793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13793_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 258
Target Start/End: Original strand, 3122147 - 3122389
Alignment:
| Q |
16 |
aagacggcccccatagaatcataatggagctattgattaagattatcgaacaataaaatttgatgttatgctacacatgaaaattgtctcatgtatgata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3122147 |
aagacggcccccatagaatcataatggagctattgattaagattatcgaacaataaaatttgatgttatgctacacatgaaaattgtctcatgtatgata |
3122246 |
T |
|
| Q |
116 |
tttacttcgaaattttatcttatgtctaactagtaaaaatttcacaaagaactattatacattaaataagccactaagtgagggttgagtggattaagtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3122247 |
tttacttcgaaattttatcttatgtctaactagtaagaatttcacaaagaactattatacattagataagccactaagtgagggttgagtggattaagtg |
3122346 |
T |
|
| Q |
216 |
tagtaagcatgaggtcctaagttcaaacctcattgtctccatg |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3122347 |
tagtaagcatgaggtcctaagttcaaacctcattgtctccatg |
3122389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 321 - 391
Target Start/End: Original strand, 3122442 - 3122512
Alignment:
| Q |
321 |
ctatcatgcatttgataagttgtcacttataaaacttcaaattcgattttacccaaagacagaataattta |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3122442 |
ctatcatgcatttgataagttgtcacttataaaacttcaaattcgattttacccaaagacagattaattta |
3122512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University