View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13793_low_15 (Length: 253)
Name: NF13793_low_15
Description: NF13793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13793_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 6 - 143
Target Start/End: Complemental strand, 785932 - 785795
Alignment:
| Q |
6 |
caaaggcattgagtagaaaaatgtagtaaaggaagagagtggttcaaaggttgtggtacgtagcactaaatttcaaaaccagtaacacaaatatccctcc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785932 |
caaaggcattgagtagaaaaatgtagtaaaggaagagagtggttcaaaggttgtggtacgtagcactaaatttcaaaaccagtaacacaaatatccctcc |
785833 |
T |
 |
| Q |
106 |
atcttcaatcatcatcttagttttgctggatttcaaat |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785832 |
atcttcaatcatcatcttagttttgctggatttcaaat |
785795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 208 - 237
Target Start/End: Complemental strand, 785730 - 785701
Alignment:
| Q |
208 |
tgggatgcactcccacttcaaccatgtttt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
785730 |
tgggatgcactcccacttcaaccatgtttt |
785701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University