View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13793_low_20 (Length: 219)

Name: NF13793_low_20
Description: NF13793
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13793_low_20
NF13793_low_20
[»] chr6 (1 HSPs)
chr6 (139-193)||(5733284-5733338)


Alignment Details
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 139 - 193
Target Start/End: Complemental strand, 5733338 - 5733284
Alignment:
139 ctgaattgtgtattagcttttgctgcttctgtttgttttgttcttgctatgtaga 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5733338 ctgaattgtgtattagcttttgctgcttctgtttgttttgttcttgctatgtaga 5733284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University