View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13795_low_12 (Length: 266)
Name: NF13795_low_12
Description: NF13795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13795_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 36002652 - 36002895
Alignment:
| Q |
16 |
aattatcacatatactacttatctatagctaataaaagtcctaacttagtttaaactttatatgctttctagcagttacattgcgtcaaacagtggatac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36002652 |
aattatcacatatactacttatctatagctaataaaagttctaacttagtttaaactttatatgctttctagcagttacattacgtcaaacagtggatac |
36002751 |
T |
 |
| Q |
116 |
caaatttcctagctttatattgtctaaagctaaattaagaagataatatttctctctttgaagcatgaaaatatttatgatttcaaggcttatgatgttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36002752 |
caaatttcctagctttatattgtctaaagctaaattaagaagataatatttctctctttgaagcatgaaaatatttatgatttcaaggcttatgatgttg |
36002851 |
T |
 |
| Q |
216 |
tgtatagatgtagtctaggtgagcttctaaagtcattcttctct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36002852 |
tgtatagatgtagtctaggtgagcttctaaagtcattcttctct |
36002895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University