View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13795_low_9 (Length: 317)
Name: NF13795_low_9
Description: NF13795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13795_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 18914618 - 18914318
Alignment:
| Q |
1 |
agcatatagacattatcagctctttaatataacttcgttatcattatagttctcaataatgcaacctttggtgttaaaagttactagtgtaccattgtcg |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
18914618 |
agcatatagacattatcaactctttaatataactttgttatcattatagttctcaataatgcaaccttcgatgttaaaagttactagtgtaccattgtcg |
18914519 |
T |
 |
| Q |
101 |
caaaattgatgcacttaaataaatttactcggttgcataagttagaacaaattttcctttctcaccaaagagtcgttgcattcatcagtgatcttaagtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18914518 |
caaaattgatgcacttaaataaatttactcggttgcataagttggaacaaattttcctttctcaccaaagagtcgttgcattcatcagtgatcttaagtc |
18914419 |
T |
 |
| Q |
201 |
agacatttggtaaagaggatctcagttcagaggcttgaactacaaagtgttgacttccataaaaca-nnnnnnnatatatgacacaaaacttcacttcaa |
299 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||||| ||||| |
|
|
| T |
18914418 |
agacgcttggtaaagaggatctcagttcagaggcttgaactataaagtgttgacttccataaagcattttttttatatatgacacaaaacttcatttcaa |
18914319 |
T |
 |
| Q |
300 |
g |
300 |
Q |
| |
|
| |
|
|
| T |
18914318 |
g |
18914318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University