View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13796_high_4 (Length: 304)
Name: NF13796_high_4
Description: NF13796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13796_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 4322547 - 4322253
Alignment:
| Q |
1 |
gaatctcttctttgttgtctttgtttcacatgcaagcaaagaccctttaaagaaccaccaacaaaatttgaacttgagtgttttaaattgatgtggttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4322547 |
gaatctcttctttgttgtctttgtttcacatgcaagcaaagaccctttaaagaaccaccaacaaaatttgaacttgagtgttttaaattgatgtggttct |
4322448 |
T |
 |
| Q |
101 |
tcaaaagtgtggaatttggtgaagaaacagcaattgctgctaccatttttgtt-acttttttg--taattgatgttgtcataaactaatgtactggtttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
4322447 |
tcaaaagtgtggaatttggtgaagaaacagcaattgctgctaccatttttgtttactttttttgtttgttgatgttgtcataaactaatgtactggtttt |
4322348 |
T |
 |
| Q |
198 |
gttgttgtaggtacat--gaagtgaaaaacactattggatatggttttgacacgtggaatattggtcttaggattttgtccaacaaggatggttgtga |
293 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4322347 |
gttgt---aggtacatatgaagtgaaaaacactattggatatggttttgacacgtggaatattggtcttaggattttgtccaacaaggatgtttgtga |
4322253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University