View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13796_low_1 (Length: 1984)

Name: NF13796_low_1
Description: NF13796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13796_low_1
NF13796_low_1
[»] chr4 (1 HSPs)
chr4 (19-153)||(11666217-11666351)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-53
Query Start/End: Original strand, 19 - 153
Target Start/End: Original strand, 11666217 - 11666351
Alignment:
19 catattccatcaacttcccaatgaagttccttttctgaaatattttctttactcataatcaaaatttcagggaaggaaacccttgggtcatgactgtcat 118  Q
    ||||||||||||| ||||||||||||||||||||||| ||| |||  ||||||||||||| |||||||||||||||||| ||||||||||||||||||||    
11666217 catattccatcaagttcccaatgaagttccttttctggaatctttgttttactcataatccaaatttcagggaaggaaaaccttgggtcatgactgtcat 11666316  T
119 gatttttcttggtgggataccctcccacaggttct 153  Q
    |||||||||||||||||||||||||||||||||||    
11666317 gatttttcttggtgggataccctcccacaggttct 11666351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University