View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13796_low_1 (Length: 1984)
Name: NF13796_low_1
Description: NF13796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13796_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-53
Query Start/End: Original strand, 19 - 153
Target Start/End: Original strand, 11666217 - 11666351
Alignment:
| Q |
19 |
catattccatcaacttcccaatgaagttccttttctgaaatattttctttactcataatcaaaatttcagggaaggaaacccttgggtcatgactgtcat |
118 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||| ||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11666217 |
catattccatcaagttcccaatgaagttccttttctggaatctttgttttactcataatccaaatttcagggaaggaaaaccttgggtcatgactgtcat |
11666316 |
T |
 |
| Q |
119 |
gatttttcttggtgggataccctcccacaggttct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11666317 |
gatttttcttggtgggataccctcccacaggttct |
11666351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University