View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13797_high_14 (Length: 293)
Name: NF13797_high_14
Description: NF13797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13797_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 137 - 278
Target Start/End: Complemental strand, 38087546 - 38087403
Alignment:
| Q |
137 |
aaacacatcttgtacgtagtgaggatgatttttaatatattttacttttgagttcttnnnnnnnn--ttatggataaggctccttagtacgaacactgaa |
234 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
38087546 |
aaacacatcttgtacgtaatgaggatgatttttaatatattttacttttgagttcttaaaaaaaaaattatggataatgctccttattacgaacactgaa |
38087447 |
T |
 |
| Q |
235 |
aaatgaaacacatgaaatgatattgtcagttgaatttctcaatc |
278 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
38087446 |
aaatgaaacacatgaaatgatatgggcagttgaatttctcaatc |
38087403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 38087680 - 38087579
Alignment:
| Q |
1 |
ctaaaggcaaataaaccggattttacttttgatattcacttttggtgtgcatagggtacaccaaaactttgtaattgtggttcttacttctgtcatctat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38087680 |
ctaaaggcaaataa-ccggattttacttttgatattcacttttggtgtgcatagg-tacaccaaaactttgtaattgtggttcttacttctgtcatcttt |
38087583 |
T |
 |
| Q |
101 |
aata |
104 |
Q |
| |
|
|||| |
|
|
| T |
38087582 |
aata |
38087579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University