View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13797_high_8 (Length: 341)
Name: NF13797_high_8
Description: NF13797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13797_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 37614309 - 37614096
Alignment:
| Q |
1 |
gttacttacttgactgtgaatgatatttgaaggatgaagagtggtgtcatatatagttgttaacatatgacagtacccttctatttcccattaatttcaa |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37614309 |
gttacttacttgattgtgaatgatatttgaaggatgaagagtggtgtcatatatagttgttaacatatgacagtacccttctatttcccattaatttcaa |
37614210 |
T |
 |
| Q |
101 |
catatgccattgtcctttaagacacgggtgagagaaaaataaataaatacattttcatttagttgtggagatgatgggaagaaatgtgatccatatcatt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37614209 |
catatgccattgtccttt-----------------aaaataaataaatacattttcatttagttgtggagatgatgggaagaaatgtgatccatatcatt |
37614127 |
T |
 |
| Q |
201 |
atatcaacatcttctctcattaaatggtagg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37614126 |
atatcaacatcttctctcattaaatggtagg |
37614096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University