View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13797_low_8 (Length: 430)
Name: NF13797_low_8
Description: NF13797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13797_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 352; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 11 - 413
Target Start/End: Complemental strand, 49994233 - 49993831
Alignment:
| Q |
11 |
catcatcaaacccccaaactcttcccaccaccactcccacaagactcaccaccatacnnnnnnnnnnnnncaacttaaatttccattcaacattgtctga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
49994233 |
catcatcaaacccccaaactcttcccaccaccactcccacaagactcaccaccatacaaaaagtaaaaaacaacttaaatttccattcaacattatctga |
49994134 |
T |
 |
| Q |
111 |
actcaatggagccatgggtgaccttggcacatacataccaatagtactttcgctcaccctttccaaaaacctcaaccttggcaccactttgattttcacc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49994133 |
actcaatggagccatgggtgaccttggcacatacataccaatagtactttcactcaccctttccaaaaacctcaaccttggcaccactttgattttcacc |
49994034 |
T |
 |
| Q |
211 |
ggcttctataacttcctcaccggtgccatgtacggtgttcctatgccagttcagcccatgaaatccatagctgccgttgcactctccgacccctctttcg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49994033 |
ggcttctataacttcctcaccggtgccatgtacggtgttcctatgccagttcagcccatgaaatccatagctgccgttgcactctccgacccctctttcg |
49993934 |
T |
 |
| Q |
311 |
gtatcccggagatcatggcttccggtatcttaaccggagctgttttattggttttgggtttaactgggttgatgaaattggcttacaagcttataccttt |
410 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49993933 |
gtatcccggagatcatggcttccggtatcttaaccggagctgttttattggttttgggttttactgggttgatgaaattggcttacaagcttataccttt |
49993834 |
T |
 |
| Q |
411 |
atg |
413 |
Q |
| |
|
||| |
|
|
| T |
49993833 |
atg |
49993831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 90 - 155
Target Start/End: Complemental strand, 25800093 - 25800028
Alignment:
| Q |
90 |
tttccattcaacattgtctgaactcaatggagccatgggtgaccttggcacatacataccaatagt |
155 |
Q |
| |
|
||||||||||| || | ||||| | ||||| |||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25800093 |
tttccattcaaaatgggctgaattaaatggtgccatgggtgaccttggcacctacatacccatagt |
25800028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 94 - 161
Target Start/End: Original strand, 1874599 - 1874666
Alignment:
| Q |
94 |
cattcaacattgtctgaactcaatggagccatgggtgaccttggcacatacataccaatagtactttc |
161 |
Q |
| |
|
||||||| || | ||||||| ||||| |||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
1874599 |
cattcaaaatgggctgaactaaatggtgccatgggtgaccttggcacctacataccaatagttctttc |
1874666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University