View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13799_high_7 (Length: 273)
Name: NF13799_high_7
Description: NF13799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13799_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 8 - 256
Target Start/End: Original strand, 51551719 - 51551967
Alignment:
| Q |
8 |
gagcacagatgaggaaaaggatcatcattggagttatttcttccgttgtcttcgtcggtctcataggttgtgcattctttgttgctaccacaaaatacaa |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51551719 |
gagcacaaatgaggaaaaggatcatcattggagttatttcttccgttgtcttcgtcggtctcataggttgtgcattctttgttgctaccacaaaatacaa |
51551818 |
T |
|
| Q |
108 |
tcctttnnnnnnnnnnnnnnnnnnnaatcatccagaagacacttcaaccgctaatggtagcaaacatgttgcacattcagaaaaggtagtgaaattggta |
207 |
Q |
| |
|
|||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51551819 |
tccttttggtggtggtggtggtggtagtcatccagaagacagttcaaccgctaatggtagcaaacatgttgcacattcagaaaaggtagtgaaattggta |
51551918 |
T |
|
| Q |
208 |
tgcagttctgcagattacaaagaaaaatgtgaaggacctcttaacaaag |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51551919 |
tgcagttctgcagattacaaagaaaaatgtgaaggacctcttaacaaag |
51551967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University