View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13799_low_10 (Length: 218)
Name: NF13799_low_10
Description: NF13799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13799_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 33901967 - 33901780
Alignment:
| Q |
16 |
acaaccactggcttcccaatagtgagagttcctgtcttatcgaacacaatgcaattcacctgaaaaattgtaagtaacaagttagtttcctactcttgaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33901967 |
acaaccactggcttcccaatagtgagagttcctgtcttatcgaacacaatgcaattcacctgaaaaattgtaagtaacaagttagtttcctactgttgaa |
33901868 |
T |
|
| Q |
116 |
atggcaagttgagagaacaatggatgcatgcaattgccaatgttatttactcaccttgtgtgcactttctaatgcttggccacctttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901867 |
atggcaagttgagagaacaatggatgcatgcaattgccaatgttatttactcaccttgtgtgcactttctaatgcttggccacctttg |
33901780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 33919339 - 33919302
Alignment:
| Q |
166 |
tcaccttgtgtgcactttctaatgcttggccacctttg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33919339 |
tcaccttgtgtgcactttctaatgcttggccacctttg |
33919302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University