View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_15 (Length: 530)
Name: NF1379_high_15
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_15 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-141; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-141
Query Start/End: Original strand, 256 - 530
Target Start/End: Original strand, 4885073 - 4885346
Alignment:
| Q |
256 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggtgtagggagaggcat |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4885073 |
atattctctcgttttgttcttttcttttctttcttaccgacgagtttttgctatgacggtgattatttttatccggtggtggcggcgtagggagaggcat |
4885172 |
T |
|
| Q |
356 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaactccgccatcttgtgttgaaggtgaagaaggtttc |
455 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4885173 |
gaggaagtaaatcttaccgcgttgaagatcagcatcgggagggacaacaacgatcttaggaacaacaccgccatcttgtgttgaaggtgaagaaggtttc |
4885272 |
T |
|
| Q |
456 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcatctcactcgacc |
530 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
4885273 |
ttgagaacatgttttgggtatgttttcatgatttcacttgctttgatgctgccactgatttcttct-actcgacc |
4885346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 94 - 196
Target Start/End: Original strand, 4884911 - 4885013
Alignment:
| Q |
94 |
gtctccacacagcaacacgtcctcttcttctatctctctgactacaaaccttctcagacagaatctcagtcaagtactgatcagaagacacaaccaacgt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4884911 |
gtctccacacagcaacacgtcctcttcttctgtctctctgactacaaaccttctcagacagaatctcagtcaagtactgatcagaagaaacaaccaacgt |
4885010 |
T |
|
| Q |
194 |
agc |
196 |
Q |
| |
|
||| |
|
|
| T |
4885011 |
agc |
4885013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University