View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_36 (Length: 386)
Name: NF1379_high_36
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 129 - 381
Target Start/End: Complemental strand, 44153484 - 44153232
Alignment:
| Q |
129 |
agcagtgttgatttggcacaaggttatatgaccaattctgatcttgaaagggtcattaaggaatttggacaaagatgtagcaacatttctaggatataca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44153484 |
agcagtgttgatttggcacaaggttatatgaccaattctgatcttgaaagggtcattaaggaatttggacaaagatgtagcaacatttctaggatataca |
44153385 |
T |
 |
| Q |
229 |
ggtgattcctcatacctgcacatagctactgtttttatcaaatatctcacagatcatgcctcaataaatgacattaatatctttttgaatgaacaaataa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44153384 |
ggtgattcctcatacctgcacatagctactgtttttatcaaatatctcacagatcatgcctcaataaatgacattaatatctttttgaatgaacaaataa |
44153285 |
T |
 |
| Q |
329 |
ctttacaaggaagttcttcttgccattgctaaactgacttaccctttgtttct |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44153284 |
ctttacaaggaagttcttcttgccattgctaaactgacttaccttttgtttct |
44153232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 44153612 - 44153534
Alignment:
| Q |
1 |
tcacagtggatctttcactgcacagcatagttacgactaaattattgctatgttatgcttgtaacttcaagtggtgctg |
79 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44153612 |
tcacagtggatctttcactgcacaacatagttatgactaaattattgctatgttatgcttgtaacttcaaatggtgctg |
44153534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University