View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_46 (Length: 344)
Name: NF1379_high_46
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 43619015 - 43618795
Alignment:
| Q |
1 |
atcaatggcatcaagtgccgctagctcttctatgttttcatcaattaggtctgcaaatttcatcataagttttgctctttcctggtcaacatatatgact |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43619015 |
atcaatggcatcaagtgctgctagctcttctatgttttcatcaattaggtccgcaaatttcatcataagttttgctctttcctggtcaacatatatgact |
43618916 |
T |
 |
| Q |
101 |
tgtcaattttaacatgctgctaaataagacgaaagtaacataagggaagagaggtgcatcaacccttaaacaaaaatttcttcattgcaatattgccccc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43618915 |
tgtcaattttaacatgctgctaaataagacgaaagtaacataagggaagagaggtgcatcaacccttaaacaaaaatttcttcattgcaatattgccccc |
43618816 |
T |
 |
| Q |
201 |
ctaaatactagcaattgcgca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
43618815 |
ctaaatactagcaattgcgca |
43618795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 20 - 66
Target Start/End: Complemental strand, 43626374 - 43626328
Alignment:
| Q |
20 |
gctagctcttctatgttttcatcaattaggtctgcaaatttcatcat |
66 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43626374 |
gctagttcttctatgttttcatcaattagttctgcaaatttcatcat |
43626328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University