View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_56 (Length: 293)
Name: NF1379_high_56
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 52 - 291
Target Start/End: Original strand, 35073510 - 35073749
Alignment:
| Q |
52 |
agtatgcaggtatacaaagcttttggttttaagcgcgtgccttaattaattttaaaattgtatctagtacattattttgtgattatagctatagcctata |
151 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35073510 |
agtatgcaggtataaaaaacttttggttttaagcgcgtgccttaattaattttaaaattgtatctagtacattattttgtgattatagctatagcctata |
35073609 |
T |
 |
| Q |
152 |
ggtactgcatcaatatcatgctctaatgtcgcgaatattttggtagtttgattgagtagctacacaaaaacaaaagttggaaggagnnnnnnntgttatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35073610 |
ggtactgcatcaatatcatgctctaatgtcgcgaatattttggtagtttgattgagtagctacacaaaaacaaaagttggaaggagaaaaaaatgttatt |
35073709 |
T |
 |
| Q |
252 |
tgatacctgatatgtgtttctgaaactctgtggtgctgct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
35073710 |
tgatacctgatatgtgtttctgaaactctttgctgctgct |
35073749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University