View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_67 (Length: 265)
Name: NF1379_high_67
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 30 - 163
Target Start/End: Complemental strand, 51905464 - 51905329
Alignment:
| Q |
30 |
gttatgatatagtcacttggcctcttattaatccacttgttcaacttattattttaggtgagttaggccgaggttttgagctaccttcttcggttagccc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51905464 |
gttatgatatagtcacttggcctcttattaatccacttgttcaacttattattttaggtgagttagggcgaggttttgagctaccttcttcggttagccc |
51905365 |
T |
 |
| Q |
130 |
gaagcatcttgttgca--gcatgttgggctgcaagc |
163 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
51905364 |
gaagcatcttgttgcaaggcatgttgggctgcaagc |
51905329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 200 - 232
Target Start/End: Complemental strand, 51905298 - 51905266
Alignment:
| Q |
200 |
gttgtactaaaaaataataagtgactcaataag |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51905298 |
gttgtactaaaaaataataagtgactcaataag |
51905266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University