View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_71 (Length: 257)
Name: NF1379_high_71
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 36 - 237
Target Start/End: Complemental strand, 31532639 - 31532438
Alignment:
| Q |
36 |
gtgtgttcatcaaagattcatgaatatgtggattaatctttggtctgtggtgctctctctagggtgggagaccttgttaggttacatcattttttaaaaa |
135 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
31532639 |
gtgtgttcatcaaagattcataaatatgtggattaatctttggtgtgtgtggctctctctaggatgagagaccttgttaggttacatcatttttttaaaa |
31532540 |
T |
 |
| Q |
136 |
cgttagattaatcaagcaaactaaattataaactaaatacacttgattattcctattgtgttagattagacaaccatctctgtttttatttttcactaca |
235 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532539 |
cgttagattgatcaagcaaactaaattataaactaaatacacttgattattcttattgtgttagattagacaaccatctctgtttttatttttcactaca |
31532440 |
T |
 |
| Q |
236 |
tc |
237 |
Q |
| |
|
|| |
|
|
| T |
31532439 |
tc |
31532438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University