View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_76 (Length: 253)
Name: NF1379_high_76
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_76 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 157 - 253
Target Start/End: Original strand, 19415998 - 19416094
Alignment:
| Q |
157 |
atgacatgaagtatacaagattgatgcaaaacgcttgtttatagcaggggtggagctagaacgggaaccactaaaggccaccgtcccacaaacattt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19415998 |
atgacatgaagtatacaagattgatgcaaaacgcttgtttatagcaggggtggagctagaacgggaaccactaaaggccaccgtcccacaaacattt |
19416094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University