View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1379_high_77 (Length: 253)

Name: NF1379_high_77
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1379_high_77
NF1379_high_77
[»] scaffold0478 (1 HSPs)
scaffold0478 (116-253)||(12114-12251)
[»] chr1 (1 HSPs)
chr1 (10-115)||(8680730-8680835)
[»] chr8 (1 HSPs)
chr8 (152-208)||(26153288-26153344)


Alignment Details
Target: scaffold0478 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: scaffold0478
Description:

Target: scaffold0478; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 116 - 253
Target Start/End: Complemental strand, 12251 - 12114
Alignment:
116 cccccggaatctggaatatcatttgcttaggcacttgctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaatcggttc 215  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
12251 cccccggaatctggaatatcgtttgctcaggcacttgctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaatccgttc 12152  T
216 gagtcaaaatcagacaaaccgaatatgaatctgggctc 253  Q
    |||||||||||| |||||||||||||||||||||||||    
12151 gagtcaaaatcacacaaaccgaatatgaatctgggctc 12114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 10 - 115
Target Start/End: Original strand, 8680730 - 8680835
Alignment:
10 gcagagacgaaacaaacatttaattcttaacaaaatgatttacaatgatatggggatgggacagggacacccgaacaaagtgatattcaatttttcagtt 109  Q
    |||| ||| ||||| ||||||||  ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
8680730 gcagggaccaaacacacatttaagccttaacaaaatgatttacaatgatacggggatgggacagggacacccgaacaaagtgatattcaatttttcagtt 8680829  T
110 tattga 115  Q
    ||||||    
8680830 tattga 8680835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 26153288 - 26153344
Alignment:
152 gctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaa 208  Q
    ||||| |||||||| ||  ||||||||||||||||||||||||||||||||||||||    
26153288 gctggtccgaaagattatcagcttactcaacttcctccgaaagttgtgatggggaaa 26153344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University