View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_high_77 (Length: 253)
Name: NF1379_high_77
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_high_77 |
 |  |
|
| [»] scaffold0478 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0478 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: scaffold0478
Description:
Target: scaffold0478; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 116 - 253
Target Start/End: Complemental strand, 12251 - 12114
Alignment:
| Q |
116 |
cccccggaatctggaatatcatttgcttaggcacttgctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaatcggttc |
215 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12251 |
cccccggaatctggaatatcgtttgctcaggcacttgctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaatccgttc |
12152 |
T |
 |
| Q |
216 |
gagtcaaaatcagacaaaccgaatatgaatctgggctc |
253 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12151 |
gagtcaaaatcacacaaaccgaatatgaatctgggctc |
12114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 10 - 115
Target Start/End: Original strand, 8680730 - 8680835
Alignment:
| Q |
10 |
gcagagacgaaacaaacatttaattcttaacaaaatgatttacaatgatatggggatgggacagggacacccgaacaaagtgatattcaatttttcagtt |
109 |
Q |
| |
|
|||| ||| ||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8680730 |
gcagggaccaaacacacatttaagccttaacaaaatgatttacaatgatacggggatgggacagggacacccgaacaaagtgatattcaatttttcagtt |
8680829 |
T |
 |
| Q |
110 |
tattga |
115 |
Q |
| |
|
|||||| |
|
|
| T |
8680830 |
tattga |
8680835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 208
Target Start/End: Original strand, 26153288 - 26153344
Alignment:
| Q |
152 |
gctggaccgaaagactacaagcttactcaacttcctccgaaagttgtgatggggaaa |
208 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26153288 |
gctggtccgaaagattatcagcttactcaacttcctccgaaagttgtgatggggaaa |
26153344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University