View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1379_high_91 (Length: 238)

Name: NF1379_high_91
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1379_high_91
NF1379_high_91
[»] chr3 (1 HSPs)
chr3 (52-140)||(39751275-39751363)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 52 - 140
Target Start/End: Complemental strand, 39751363 - 39751275
Alignment:
52 aaccacggccacaggaccaattgctatttctcttgatgttcccattacagcgtatataagcggtggtacaacactcgtatctatttcat 140  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39751363 aaccacggccacaggaccaattgctatttctcttgatgttcccattacagcgtatataagcggtggtacaacactcgtatctatttcat 39751275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University