View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1379_high_93 (Length: 230)

Name: NF1379_high_93
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1379_high_93
NF1379_high_93
[»] chr1 (1 HSPs)
chr1 (1-119)||(49656994-49657112)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 49656994 - 49657112
Alignment:
1 ttaatattagtggtgccacctaccaatcaccctcttgcttctcttttgctgaattatcaccacaaatctgtgatcctaattaattcgcattatactacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49656994 ttaatattagtggtgccacctaccaatcaccctcttgcttctcttttgctgaattatcaccacaaatctgtgatcctaattaattcgcattatactacca 49657093  T
101 tcattcagaccttcactct 119  Q
    |||||||||||||||||||    
49657094 tcattcagaccttcactct 49657112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University