View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_106 (Length: 240)
Name: NF1379_low_106
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 30 - 108
Target Start/End: Original strand, 41564714 - 41564792
Alignment:
| Q |
30 |
tttaggctacaaatgaaacatcaccgtccacccccatccaccaacttcacatagttggacaaggatcaagattctctct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41564714 |
tttaggctacaaatgaaacatcaccgtccacccccatccaccaacttcacatagttggacaaggatcaagattctctct |
41564792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 132 - 240
Target Start/End: Original strand, 41564808 - 41564916
Alignment:
| Q |
132 |
aaggaaacaatgtaaaaaatttgatctttcatcaccacattatttttcaagnnnnnnnctctcaacaaaataaccggtttggttttttattataattata |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
41564808 |
aaggaaacaatgtaaaaaatttgatcattcatcaccacaatatttttcaagtttttttctctcaacaaaataaccggtttggtttattattataattgta |
41564907 |
T |
 |
| Q |
232 |
tccaggcaa |
240 |
Q |
| |
|
||||||||| |
|
|
| T |
41564908 |
tccaggcaa |
41564916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University