View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1379_low_114 (Length: 204)

Name: NF1379_low_114
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1379_low_114
NF1379_low_114
[»] chr1 (1 HSPs)
chr1 (4-181)||(44153635-44153813)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 4 - 181
Target Start/End: Complemental strand, 44153813 - 44153635
Alignment:
4 ggggtgataaataagagtttacatggttacgatagttaaataacaggataag-ttttatgtttagcttgaatggtggatgtttgaagttttttatgaatt 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
44153813 ggggtgataaataagagtttacatggttacgatagttaaataacaggataaggttttatgtttagcttgaatggtggatgtttgaagttttttatgaatt 44153714  T
103 ctaattgcatgtttgttttggtattagaagatttcaatgatcggattaatgtaagccgtgcaaggcgtttgcttgatga 181  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
44153713 ctaattgcatgtttgttttggtattagaagatttcaatgaccggattaatgtaagccgtgcaaggcgtttgcttgatga 44153635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University