View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_114 (Length: 204)
Name: NF1379_low_114
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_114 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 4 - 181
Target Start/End: Complemental strand, 44153813 - 44153635
Alignment:
| Q |
4 |
ggggtgataaataagagtttacatggttacgatagttaaataacaggataag-ttttatgtttagcttgaatggtggatgtttgaagttttttatgaatt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44153813 |
ggggtgataaataagagtttacatggttacgatagttaaataacaggataaggttttatgtttagcttgaatggtggatgtttgaagttttttatgaatt |
44153714 |
T |
 |
| Q |
103 |
ctaattgcatgtttgttttggtattagaagatttcaatgatcggattaatgtaagccgtgcaaggcgtttgcttgatga |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44153713 |
ctaattgcatgtttgttttggtattagaagatttcaatgaccggattaatgtaagccgtgcaaggcgtttgcttgatga |
44153635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University