View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_115 (Length: 203)
Name: NF1379_low_115
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_115 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 44153792 - 44153897
Alignment:
| Q |
1 |
gtaaactcttatttatcaccccctaagttacactctttcacttcaaacatataaaaaagtcaacatttgaaattttccac-aatctcactatgtaagaac |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44153792 |
gtaaactcttatttatcacccc-taagttacactctttcacttcaaacatataaaaaagtcaacatttgaaattttccacaaatctcactatgtaagaac |
44153890 |
T |
 |
| Q |
100 |
taactac |
106 |
Q |
| |
|
||||||| |
|
|
| T |
44153891 |
taactac |
44153897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University