View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_46 (Length: 366)
Name: NF1379_low_46
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1379_low_46 |
![](./plan/images/spacer.gif) | ![NF1379_low_46](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 22 - 317
Target Start/End: Complemental strand, 51905227 - 51904930
Alignment:
Q |
22 |
aaagttttaagctgtttttgaattcgagaagtctatgnnnnnnnnnnnnnactacatc--aatatgaaatgacatgtaagtaagctaaatgttatgcttg |
119 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51905227 |
aaagttttaagctgtttttgaattcgagaagtctatgtttttctttttttactacatcttaatatgaaatgacatgtaagtaagctaaatgttatgcttg |
51905128 |
T |
![](./plan/images/spacer.gif) |
Q |
120 |
aattgtttgtaggcgatgttgaaaattagatcgtataacaaaagagtttggatggaatgtgtggtttttcttaatactacaatatttgtttgatcaccac |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51905127 |
aattgtttgtaggcgatgttgaaaattagatcgtataacaaaagagtttggatggaatgtgtggtttttcttaatactacaatatttgtttgatcaccac |
51905028 |
T |
![](./plan/images/spacer.gif) |
Q |
220 |
aataacaaaaaactatttttctttagatgagatttaaatttgaataaaataatccacttgtgtgtcataaattgttatttagttgagattttcctatg |
317 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51905027 |
aataacaaaaaactatttttctttagatgagatttaaatttgaataaaataatccacttgtgtgtcataaattgttatttagttgagattttcctatg |
51904930 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 11478 times since January 2019
Visitors: 1121