View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_49 (Length: 354)
Name: NF1379_low_49
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 86 - 343
Target Start/End: Complemental strand, 30475005 - 30474749
Alignment:
| Q |
86 |
atattttcctcaactctaacaaacttgagattttaaagtgaaaggatcaatatagataatgacctagaataaaattttgtgaaaaccattccataaggcc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| | |
|
|
| T |
30475005 |
atattttcctcaactctaacaaacttgagattttaaagtgaaaggatcaatatagataatgacctagaataaaattttgtgaaaaccatac-ataagggc |
30474907 |
T |
|
| Q |
186 |
aaaaagttctatccaccaaaacataccacatgtgcatcactatccaccaaaacaactttaaatggatgccaattcgggtcctttatactctcttcccacg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30474906 |
aaaaagttctatccaccaaaacataccacatgtgcatcactatccaccaaaacaactttaaatggatgccaatttgggtcctttatactctcttcccacg |
30474807 |
T |
|
| Q |
286 |
aagagcataattttgcagctctatttttagctgttctcgcattgaatcttttcttcat |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30474806 |
aagagcataattttgcagctctatttttagctgttctcgcattgaatcttttcttcat |
30474749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University