View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1379_low_59 (Length: 331)
Name: NF1379_low_59
Description: NF1379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1379_low_59 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 68 - 243
Target Start/End: Original strand, 49083924 - 49084099
Alignment:
| Q |
68 |
agaccaaaatcttgatgaatatctcactgatttgcttatgaatcattctcataaaccagagagatcttcattgtggaattcagatttatcggttgtcacg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083924 |
agaccaaaatcttgatgaatatctcactgatttgcttatgaatcattctcataaaccaaagagatcttcattgtggaattcagatttatcggttgtcacg |
49084023 |
T |
|
| Q |
168 |
ctatcaaaacctgaaatgtggaaaacttgcatcccttgtggcaaaatctatctctttaggtgaataaaccttcaca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084024 |
ctatcaaaacctgaaatgtggaaaacttgcatcccttgtggcaaaatctatctctttaggtgaataaaccttcaca |
49084099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University